Review



rnai consortium trcn0000240480 trcn0000181026 pljc6 3xha tmem192 addgene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc rnai consortium trcn0000240480 trcn0000181026 pljc6 3xha tmem192 addgene
    Rnai Consortium Trcn0000240480 Trcn0000181026 Pljc6 3xha Tmem192 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnai+consortium/pm41397976-202-139-144?v=Addgene+inc
    Average 93 stars, based on 9 article reviews
    rnai consortium trcn0000240480 trcn0000181026 pljc6 3xha tmem192 addgene - by Bioz Stars, 2026-06
    93/100 stars

    Images



    Similar Products

    96
    Broad Clinical Labs rnai consortium trc version 1 library
    Rnai Consortium Trc Version 1 Library, supplied by Broad Clinical Labs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnai+consortium/pm39374726-121-31-37?v=Broad+Clinical+Labs
    Average 96 stars, based on 1 article reviews
    rnai consortium trc version 1 library - by Bioz Stars, 2026-06
    96/100 stars
      Buy from Supplier

    94
    OriGene sr301535 scramble shrna 5 caacaagatgaagagcaccaa 3 rnai consortium trc n a fat2 shrna 1
    Sr301535 Scramble Shrna 5 Caacaagatgaagagcaccaa 3 Rnai Consortium Trc N A Fat2 Shrna 1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnai+consortium/pm41579862-800-109-107?v=OriGene
    Average 94 stars, based on 1 article reviews
    sr301535 scramble shrna 5 caacaagatgaagagcaccaa 3 rnai consortium trc n a fat2 shrna 1 - by Bioz Stars, 2026-06
    94/100 stars
      Buy from Supplier

    93
    Addgene inc rnai consortium trcn0000240480 trcn0000181026 pljc6 3xha tmem192 addgene
    Rnai Consortium Trcn0000240480 Trcn0000181026 Pljc6 3xha Tmem192 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnai+consortium/pm41397976-202-139-144?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    rnai consortium trcn0000240480 trcn0000181026 pljc6 3xha tmem192 addgene - by Bioz Stars, 2026-06
    93/100 stars
      Buy from Supplier

    96
    Addgene inc rnai consortium
    Rnai Consortium, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnai+consortium/bio_rxiv__2025__06__28__661837-214-36-38?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    rnai consortium - by Bioz Stars, 2026-06
    96/100 stars
      Buy from Supplier

    93
    OriGene rnai consortium cat
    Rnai Consortium Cat, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnai+consortium/pm40131931-273-103-124?v=OriGene
    Average 93 stars, based on 1 article reviews
    rnai consortium cat - by Bioz Stars, 2026-06
    93/100 stars
      Buy from Supplier

    94
    Addgene inc rnai consortium trcn0000240584 recombinant dna paav camkiia egfp cre addgene addgene
    Rnai Consortium Trcn0000240584 Recombinant Dna Paav Camkiia Egfp Cre Addgene Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnai+consortium/pm40208794-239-149-155?v=Addgene+inc
    Average 94 stars, based on 1 article reviews
    rnai consortium trcn0000240584 recombinant dna paav camkiia egfp cre addgene addgene - by Bioz Stars, 2026-06
    94/100 stars
      Buy from Supplier

    90
    Broad Institute Inc rnai consortium (trc) shrna library
    Immunoblotting of PAI-1 protein in HCT116 MD and HD knocked down for the protein using two unique shRNAs ( A ). Fold change of PAI-1 protein in cell culture supernatant of HCT116 MD and HD knocked down for the protein relative to MD <t>shRNA</t> control (shCtrl) ( B ). Fold change of dose response to 48 hrs oxaliplatin treatment in HCT116 MD and HD knocked down for the protein relative to MD shCtrl ( C ). Representative dose response curves of HCT116-MD shCtrl, PAI-1 sh3 and sh5 ( D ) and HCT116-HD shCtrl, PAI-1 sh3 and sh5 ( E ) to 48 hrs of oxaliplatin treatment. F-F’, Inhibition of metastasis in oxaliplatin treated HCT116 model using tiplaxtinin. Three representative H&E staining and corresponding quantifications ( F and F’ ) of lung sections from mice harboring HCT116 PAR xenografts treated with oxaliplatin, alone or in combination with tiplaxtinin, until spontaneous metastasis (refer to section ‘Impact of concomitant administration of tiplaxtinin and oxaliplatin on metastasis’ under Materials and Methods). For quantification number of nodule positive area was normalized to total lung area (n= at least 8). Statistical significance was determined using Ordinary one-way ANOVA followed by Sidak’s multiple comparisons test for Fig. B, C, and using two-tailed unpaired t-test for Fig. F’. A p-value of <0.05 was considered significant for all analyses, unless stated otherwise.
    Rnai Consortium (Trc) Shrna Library, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnai+consortium/bio_rxiv__2024__12__17__628817-253-10-15?v=Broad+Institute+Inc
    Average 90 stars, based on 1 article reviews
    rnai consortium (trc) shrna library - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Broad Institute Inc rnai consortium collection tool
    Immunoblotting of PAI-1 protein in HCT116 MD and HD knocked down for the protein using two unique shRNAs ( A ). Fold change of PAI-1 protein in cell culture supernatant of HCT116 MD and HD knocked down for the protein relative to MD <t>shRNA</t> control (shCtrl) ( B ). Fold change of dose response to 48 hrs oxaliplatin treatment in HCT116 MD and HD knocked down for the protein relative to MD shCtrl ( C ). Representative dose response curves of HCT116-MD shCtrl, PAI-1 sh3 and sh5 ( D ) and HCT116-HD shCtrl, PAI-1 sh3 and sh5 ( E ) to 48 hrs of oxaliplatin treatment. F-F’, Inhibition of metastasis in oxaliplatin treated HCT116 model using tiplaxtinin. Three representative H&E staining and corresponding quantifications ( F and F’ ) of lung sections from mice harboring HCT116 PAR xenografts treated with oxaliplatin, alone or in combination with tiplaxtinin, until spontaneous metastasis (refer to section ‘Impact of concomitant administration of tiplaxtinin and oxaliplatin on metastasis’ under Materials and Methods). For quantification number of nodule positive area was normalized to total lung area (n= at least 8). Statistical significance was determined using Ordinary one-way ANOVA followed by Sidak’s multiple comparisons test for Fig. B, C, and using two-tailed unpaired t-test for Fig. F’. A p-value of <0.05 was considered significant for all analyses, unless stated otherwise.
    Rnai Consortium Collection Tool, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnai+consortium/pmc11531574-99-1-5?v=Broad+Institute+Inc
    Average 90 stars, based on 1 article reviews
    rnai consortium collection tool - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    90
    Broad Institute Inc trc library database of the rnai consortium shrna library
    Immunoblotting of PAI-1 protein in HCT116 MD and HD knocked down for the protein using two unique shRNAs ( A ). Fold change of PAI-1 protein in cell culture supernatant of HCT116 MD and HD knocked down for the protein relative to MD <t>shRNA</t> control (shCtrl) ( B ). Fold change of dose response to 48 hrs oxaliplatin treatment in HCT116 MD and HD knocked down for the protein relative to MD shCtrl ( C ). Representative dose response curves of HCT116-MD shCtrl, PAI-1 sh3 and sh5 ( D ) and HCT116-HD shCtrl, PAI-1 sh3 and sh5 ( E ) to 48 hrs of oxaliplatin treatment. F-F’, Inhibition of metastasis in oxaliplatin treated HCT116 model using tiplaxtinin. Three representative H&E staining and corresponding quantifications ( F and F’ ) of lung sections from mice harboring HCT116 PAR xenografts treated with oxaliplatin, alone or in combination with tiplaxtinin, until spontaneous metastasis (refer to section ‘Impact of concomitant administration of tiplaxtinin and oxaliplatin on metastasis’ under Materials and Methods). For quantification number of nodule positive area was normalized to total lung area (n= at least 8). Statistical significance was determined using Ordinary one-way ANOVA followed by Sidak’s multiple comparisons test for Fig. B, C, and using two-tailed unpaired t-test for Fig. F’. A p-value of <0.05 was considered significant for all analyses, unless stated otherwise.
    Trc Library Database Of The Rnai Consortium Shrna Library, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnai+consortium/bio_rxiv__2024__10__16__618596-92-15-19?v=Broad+Institute+Inc
    Average 90 stars, based on 1 article reviews
    trc library database of the rnai consortium shrna library - by Bioz Stars, 2026-06
    90/100 stars
      Buy from Supplier

    96
    Broad Clinical Labs rnai consortium shrna library
    Immunoblotting of PAI-1 protein in HCT116 MD and HD knocked down for the protein using two unique shRNAs ( A ). Fold change of PAI-1 protein in cell culture supernatant of HCT116 MD and HD knocked down for the protein relative to MD <t>shRNA</t> control (shCtrl) ( B ). Fold change of dose response to 48 hrs oxaliplatin treatment in HCT116 MD and HD knocked down for the protein relative to MD shCtrl ( C ). Representative dose response curves of HCT116-MD shCtrl, PAI-1 sh3 and sh5 ( D ) and HCT116-HD shCtrl, PAI-1 sh3 and sh5 ( E ) to 48 hrs of oxaliplatin treatment. F-F’, Inhibition of metastasis in oxaliplatin treated HCT116 model using tiplaxtinin. Three representative H&E staining and corresponding quantifications ( F and F’ ) of lung sections from mice harboring HCT116 PAR xenografts treated with oxaliplatin, alone or in combination with tiplaxtinin, until spontaneous metastasis (refer to section ‘Impact of concomitant administration of tiplaxtinin and oxaliplatin on metastasis’ under Materials and Methods). For quantification number of nodule positive area was normalized to total lung area (n= at least 8). Statistical significance was determined using Ordinary one-way ANOVA followed by Sidak’s multiple comparisons test for Fig. B, C, and using two-tailed unpaired t-test for Fig. F’. A p-value of <0.05 was considered significant for all analyses, unless stated otherwise.
    Rnai Consortium Shrna Library, supplied by Broad Clinical Labs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnai+consortium/pmc11306111-343-16-20?v=Broad+Clinical+Labs
    Average 96 stars, based on 1 article reviews
    rnai consortium shrna library - by Bioz Stars, 2026-06
    96/100 stars
      Buy from Supplier

    Image Search Results


    Immunoblotting of PAI-1 protein in HCT116 MD and HD knocked down for the protein using two unique shRNAs ( A ). Fold change of PAI-1 protein in cell culture supernatant of HCT116 MD and HD knocked down for the protein relative to MD shRNA control (shCtrl) ( B ). Fold change of dose response to 48 hrs oxaliplatin treatment in HCT116 MD and HD knocked down for the protein relative to MD shCtrl ( C ). Representative dose response curves of HCT116-MD shCtrl, PAI-1 sh3 and sh5 ( D ) and HCT116-HD shCtrl, PAI-1 sh3 and sh5 ( E ) to 48 hrs of oxaliplatin treatment. F-F’, Inhibition of metastasis in oxaliplatin treated HCT116 model using tiplaxtinin. Three representative H&E staining and corresponding quantifications ( F and F’ ) of lung sections from mice harboring HCT116 PAR xenografts treated with oxaliplatin, alone or in combination with tiplaxtinin, until spontaneous metastasis (refer to section ‘Impact of concomitant administration of tiplaxtinin and oxaliplatin on metastasis’ under Materials and Methods). For quantification number of nodule positive area was normalized to total lung area (n= at least 8). Statistical significance was determined using Ordinary one-way ANOVA followed by Sidak’s multiple comparisons test for Fig. B, C, and using two-tailed unpaired t-test for Fig. F’. A p-value of <0.05 was considered significant for all analyses, unless stated otherwise.

    Journal: bioRxiv

    Article Title: Modelling oxaliplatin resistance in colorectal cancer reveals a SERPINE1 -based gene signature (RESIST-M) and therapeutic strategies for pro-metastatic CMS4 subtype

    doi: 10.1101/2024.12.17.628817

    Figure Lengend Snippet: Immunoblotting of PAI-1 protein in HCT116 MD and HD knocked down for the protein using two unique shRNAs ( A ). Fold change of PAI-1 protein in cell culture supernatant of HCT116 MD and HD knocked down for the protein relative to MD shRNA control (shCtrl) ( B ). Fold change of dose response to 48 hrs oxaliplatin treatment in HCT116 MD and HD knocked down for the protein relative to MD shCtrl ( C ). Representative dose response curves of HCT116-MD shCtrl, PAI-1 sh3 and sh5 ( D ) and HCT116-HD shCtrl, PAI-1 sh3 and sh5 ( E ) to 48 hrs of oxaliplatin treatment. F-F’, Inhibition of metastasis in oxaliplatin treated HCT116 model using tiplaxtinin. Three representative H&E staining and corresponding quantifications ( F and F’ ) of lung sections from mice harboring HCT116 PAR xenografts treated with oxaliplatin, alone or in combination with tiplaxtinin, until spontaneous metastasis (refer to section ‘Impact of concomitant administration of tiplaxtinin and oxaliplatin on metastasis’ under Materials and Methods). For quantification number of nodule positive area was normalized to total lung area (n= at least 8). Statistical significance was determined using Ordinary one-way ANOVA followed by Sidak’s multiple comparisons test for Fig. B, C, and using two-tailed unpaired t-test for Fig. F’. A p-value of <0.05 was considered significant for all analyses, unless stated otherwise.

    Article Snippet: To generate stable knockdown lines, suitable bacteria clones from the RNAi Consortium (TRC) shRNA Library (Broad Institute) were selected and sub-cultured in terrific Broth (CUS-4051-1L, Axil Scientific) supplemented with 1X carbenicillin (10177012, ThermoFisher).

    Techniques: Western Blot, Cell Culture, shRNA, Control, Inhibition, Staining, Two Tailed Test